TLR1 coding exon of Sciurus vulgaris: specimen R20/15 - SRA

SRX1850068: TLR1 coding exon of Sciurus vulgaris: specimen R20/15
1 ILLUMINA (Illumina MiSeq) run: 191,372 spots, 115.2M bases, 82Mb downloads

Design: We designed primers flanking the TLR1 coding exon (F: GGAAACCACCCTTTGTCTCA, R: AAAGGGTGAACTGAGGACTGAA) and amplified 2.7 kb-long amplicons. Fragmentation of the PCR product was performed by an enzymatic procedure. Briefly, 32 ?l of amplicons were mixed with 4 ?l of 10X Fragmentase Reaction Buffer v2 (New England Biolabs, USA, MA) and 4 ?l of ds Fragmentase. The mix was incubated 5 min at 37°C and the reaction stopped with 10 ?l of EDTA 0.5M. The reaction was purified using AMPure XP beads (Beckman Coulter USA, IN) with a 1.8X volume. Sequencing libraries were synthesized with the Kapa Hyper prep kit (Kapa Biosystems, Wilmington, MA, USA), according to the manufacturer’s instructions. PentAdaptersTM (PentaBase, APS, Denmark) were used to barcode the library and were diluted according to Kapa’s recommendation and the starting DNA concentration. After the final amplification step, libraries were quantified using Qubit dsDNA BR Assay Kit (Thermo Fisher Sc., USA, MA) and the fragment size was assessed by Fragment Analyzer (Advanced Analytical Technologies, Inc. Ankeny, USA).

Submitted by: Ecole Polytechnique Federale de Lausanne

Study: TLR1 variation linked with leprosy in Sciurus vulgaris from the British Isles

PRJNA325827 • SRP076649 • All experiments • All runs

show Abstracthide Abstract

Mutations in TLR1 have been found to be associated with leprosy in humans and armadillos. In this study we sequenced the TLR1 coding sequence of red squirrels from the British Isles. We compared red squirrels infected with leprosy-causing bacteria (Mycobacterium leprae or Mycobacterium lepromatosis) with PCR-negative squirrels.

Sample: Sciurus vulgaris specimen R20/15, PCR-negative for M. leprae and M. lepromatosis

SAMN05255341 • SRS1507919 • All experiments • All runs

Organism: Sciurus vulgaris

Library:

Name: R20/15_TLR1

Instrument: Illumina MiSeq

Strategy: AMPLICON

Source: GENOMIC

Selection: PCR

Layout: PAIRED

Runs: 1 run, 191,372 spots, 115.2M bases, 82Mb

Run	# of Spots	# of Bases	Size	Published
SRR3674432	191,372	115.2M	82Mb	2016-09-30

ID:: 2643830

SRA

Sequence Read Archive

Result Filters

Send to:

Supplemental Content

Related information

Recent activity